SIMPLE SOLUTIONS

FAIDX - reference manual online

An index enabling random access to FASTA files.

Chapter
August 2013
faidx(5)                              Bioinformatics formats                             faidx(5)

NAME faidx - an index enabling random access to FASTA files
SYNOPSIS file.fa.fai, file.fasta.fai
DESCRIPTION Using an fai index file in conjunction with a FASTA file containing reference sequences enables efficient access to arbitrary regions within those reference sequences. The index file typically has the same filename as the corresponding FASTA file, with .fai appended. An fai index file is a text file consisting of lines each with five TAB-delimited columns: NAME Name of this reference sequence LENGTH Total length of this reference sequence, in bases OFFSET Offset within the FASTA file of this sequence's first base LINEBASES The number of bases on each line LINEWIDTH The number of bytes in each line, including the newline The NAME and LENGTH columns contain the same data as would appear in the SN and LN fields of a SAM @SQ header for the same reference sequence. The OFFSET column contains the offset within the FASTA file, in bytes starting from zero, of the first base of this reference sequence, i.e., of the character following the newline at the end of the ">" header line. Typically the lines of a fai index file appear in the order in which the reference sequences appear in the FASTA file, so .fai files are typi‐ cally sorted according to this column. The LINEBASES column contains the number of bases in each of the sequence lines that form the body of this reference sequence, apart from the final line which may be shorter. The LINEWIDTH column contains the number of bytes in each of the sequence lines (except per‐ haps the final line), thus differing from LINEBASES in that it also counts the bytes form‐ ing the line terminator. FASTA Files In order to be indexed with samtools faidx, a FASTA file must be a text file of the form >name [description...] ATGCATGCATGCATGCATGCATGCATGCAT GCATGCATGCATGCATGCATGCATGCATGC ATGCAT >name [description...] ATGCATGCATGCAT GCATGCATGCATGC [...] In particular, each reference sequence must be "well-formatted", i.e., all of its sequence lines must be the same length, apart from the final sequence line which may be shorter. (While this sequence line length must be the same within each sequence, it may vary between different reference sequences in the same FASTA file.) This also means that although the FASTA file may have Unix- or Windows-style or other line termination, the newline characters present must be consistent, at least within each ref‐ erence sequence. The samtools implementation uses the first word of the ">" header line text (i.e., up to the first whitespace character) as the NAME column. At present, there may be no white‐ space between the ">" character and the name.
EXAMPLE For example, given this FASTA file >one ATGCATGCATGCATGCATGCATGCATGCAT GCATGCATGCATGCATGCATGCATGCATGC ATGCAT >two another chromosome ATGCATGCATGCAT GCATGCATGCATGC formatted with Unix-style (LF) line termination, the corresponding fai index would be one 66 5 30 31 two 28 98 14 15 If the FASTA file were formatted with Windows-style (CR-LF) line termination, the fai index would be one 66 6 30 32 two 28 103 14 16
SEE ALSO samtools(1) http://en.wikipedia.org/wiki/FASTA_format Further description of the FASTA format
htslib August 2013 faidx(5)
This manual Reference Other manuals
faidx(5) referred by
refer to samtools(1)